Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17307053

Morpholino Name: errfi1 MO1
Synonyms: Xmig6
mRNA Target: errfi1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCGGCTGTCATTCCTTCAACTATGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 22/25
genomic

MO
5' TTGTAGTTGAAGGAATGACAGCTGC 3' ||||||||||||||||||| || 3' GGTATCAACTTCCTTACTGTCGGCG 5' 5' TTTTAGTTGAAGGAATGACAGCCGC 3' |||||||||||||||||||||| 3' GGTATCAACTTCCTTACTGTCGGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold208071:1197272..1197296 22/25 Antisense target errfi1.S
Scaffold107078:490338..490362 21/25 Antisense off-target Xelaev16001897m
Scaffold67738:562861..562885 21/25 Antisense off-target acad9.S
tropicalis 7.1 scaffold_7:91584895..91584919 21/25 Antisense target errfi1
scaffold_8:31292958..31292982 21/25 unknown
Publications
First: Screening of FGF target genes in Xenopus by microarray: temporal dissection of the signalling pathway using a chemical inhibitor., Genes Cells 2004                              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556