Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17307054

Morpholino Name: mgc69520 MO2
Synonyms: XGPCR4, flop1 MO
mRNA Target: mgc69520

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' CACGACACGCTCTGGTTACACATTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAATGTGTAACCAGAGCGTGTCGTG 3' ||||||||||||||||||||||||| 3' CTTACACATTGGTCTCGCACAGCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold39723:10411145..10411169 25/25 Antisense off-target Xelaev16050968m
Scaffold50079:1729505..1729529 25/25 Antisense target mgc69520.S
tropicalis 7.1 scaffold_8:78543764..78543788 25/25 Antisense off-target mgc69520
scaffold_8:78543764..78543788 25/25 Antisense off-target unnamed
scaffold_5:85088245..85088269 21/25 unknown
Publications
First: Screening of FGF target genes in Xenopus by microarray: temporal dissection of the signalling pathway using a chemical inhibitor., Genes Cells 2004                              
Most recent: G protein-coupled receptors Flop1 and Flop2 inhibit Wnt/β-catenin signaling and are essential for head formation in Xenopus., Dev Biol 2015                                            
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556