Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310721

Morpholino Name: etv2 MO5
Synonyms: er71-Mo-xl-2
Target mRNA: etv2

Morpholino Type: uncategorized morpholino
Sequence: 5' GCGAGCTCTGGGCAGTAGTAGATAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genomic

MO
5' GCATCTACTACTGCCCAGAGCTTGC 3' | |||||||||||||||||||| || 3' CATAGATGATGACGGGTCTCGAGCG 5' 5' GTATCTACTACTGCCCAGAGCTCGC 3' ||||||||||||||||||||||||| 3' CATAGATGATGACGGGTCTCGAGCG 5' 5' GTATCTACTACTGCCCAGAGCTCGC 3' ||||||||||||||||||||||||| 3' CATAGATGATGACGGGTCTCGAGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:122107210..122107234 25/25 Antisense target etv2.L
chr7S:87474149..87474173 25/25 Antisense target etv2.S
chr7L:75568409..75568433 21/25 unknown
tropicalis 10.0 Chr7:129076286..129076310 23/25 Antisense target etv2
Publications
First: Xenopus er71 is involved in vascular development., Dev Dyn 2010              
Most recent:
View All Papers