Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310722

Morpholino Name: tnik MO3
Synonyms:
mRNA Target: tnik

Morpholino Type: uncategorized morpholino
Sequence:
5' GTACACTGCTCCCCGTTCTTCCCAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 22/25
genomic

MO
5' GTGGGAAGAACGGGGAGCTCTGTGC 3' |||||||||||||||||| ||| | 3' CACCCTTCTTGCCCCTCGTCACATG 5' 5' GTGGAAAGAACGGGGAGCTGTGTGC 3' |||| ||||||||||||| |||| | 3' CACCCTTCTTGCCCCTCGTCACATG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:107962332..107962356 25/25 Antisense off-target LOC108717011 [provisional:tnik]
chr5S:92456628..92456652 22/25 Antisense target tnik.S
tropicalis 10.0 Chr5:111489773..111489797 22/25 Antisense target tnik
Chr8:138196305..138196329 21/25 Antisense off-target dcaf8
Publications
First: Agonistic and antagonistic roles for TNIK and MINK in non-canonical and canonical Wnt signalling., PLoS One 2012                  
Most recent:
View All Papers