Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310727

Morpholino Name: etv6 MO1
Synonyms: tel1
mRNA Target: etv6

Morpholino Type: Translation Blocking(ATG)
Sequence:
5' GTAACACTGGGCTGAAGACATTTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: Tel1/ETV6 specifies blood stem cells through the agency of VEGF signaling. [Dev Cell 2010]
Most recent: VEGFA-dependent and -independent pathways synergise to drive Scl expression and initiate programming of the blood stem cell lineage in Xenopus. [Development 2013]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556