Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310729

Morpholino Name: kdr MO1
Synonyms: flk1
mRNA Target: kdr

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' AGCCCAGCAGCACAGCCTCCATGTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AACATGGAGGCTGTGCTGCTGGGCT 3' ||||||||||||||||||||||||| 3' TTGTACCTCCGACACGACGACCCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold32657:1619843..1619867 25/25 Antisense target kdr.L
Scaffold31653:1725302..1725326 22/25 Antisense off-target Xelaev16042322m
Scaffold59883:3782414..3782438 21/25 unknown
Scaffold79772:597856..597880 21/25 Sense off-target rtkn2.L
Publications
First: Tel1/ETV6 specifies blood stem cells through the agency of VEGF signaling., Dev Cell 2010                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556