Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310743

Morpholino Name: hdac1 MO1
Synonyms: HDAC1A-MO
mRNA Target: hdac1

Morpholino Type: uncategorized morpholino
Sequence:
5' TCAGCGCCATTTTCCTTCCGCGTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genomic

MO
5' AGCCGCGGAAGGAAAATGGCGCTGA 3' || |||||||||||||||||||||| 3' TCTGCGCCTTCCTTTTACCGCGACT 5' 5' AGACGCGGAAGGAAAATGGCGCTGA 3' ||||||||||||||||||||||||| 3' TCTGCGCCTTCCTTTTACCGCGACT 5' 5' AGCCGCCGAAGGAAAATGGCGCTGA 3' || ||| |||||||||||||||||| 3' TCTGCGCCTTCCTTTTACCGCGACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold298574:92461..92485 25/25 Antisense target hdac1.L
Scaffold166674:3177743..3177767 23/25 Antisense target hdac1.S
Scaffold21603:6235847..6235871 21/25 unknown
tropicalis 7.1 scaffold_2:10784318..10784342 24/25 Antisense target hdac1
scaffold_2:10784318..10784342 24/25 Sense off-target tor2a
Publications
First: HDAC1 Regulates the Proliferation of Radial Glial Cells in the Developing Xenopus Tectum., PLoS One 2015                  
Most recent: A novel role for Ascl1 in the regulation of mesendoderm formation via HDAC-dependent antagonism of VegT., Development 2016                              
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556