Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310746

Morpholino Name: pax8 MO3
Synonyms:
Target mRNA: pax8

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGCTGCTGTTGGGCATCTTCCTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 24/25
genomic

MO
5' GGAGGAAGATGCCCAACAGCAGCAT 3' ||||||||||||||||||||||||| 3' CCTCCTTCTACGGGTTGTCGTCGTA 5' 5' AGAAGAAGATGCCCAACAGCAGCAT 3' || ||||||||||||||||||||| 3' CCTCCTTCTACGGGTTGTCGTCGTA 5' 5' GGAGCAAGATGCCCAACAGCAGCAT 3' |||| |||||||||||||||||||| 3' CCTCCTTCTACGGGTTGTCGTCGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:26440502..26440526 24/25 Antisense target pax8.S
chr3L:118183505..118183529 23/25 Antisense target pax8.L
chr3L:2845893..2845917 21/25 Antisense off-target smc1b.L
chr7S:13021041..13021065 21/25 unknown
tropicalis 10.0 Chr3:125804973..125804997 25/25 Antisense target pax8
Chr1:183499107..183499131 21/25 Antisense off-target arhgef28
Chr3:3150111..3150135 21/25 Antisense off-target smc1b
Publications
First: Exon capture and bulk segregant analysis: rapid discovery of causative mutations using high-throughput sequencing., BMC Genomics 2012                    
Most recent: CRISPR/Cas9: An inexpensive, efficient loss of function tool to screen human disease genes in Xenopus., Dev Biol 2015              
View All Papers