Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310747

Morpholino Name: rab11b.1 MO1
Synonyms: rab11b
mRNA Target: rab11b.1

Morpholino Type:
Sequence:
5' CGTATTCGTCATCTCTGGCTCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGGGAGCCAGAGATGACGAATACG 3' ||||||||||||||||||||||||| 3' TACCCTCGGTCTCTACTGCTTATGC 5' 5' ATGGGAGCCAGAGATGACGAATACG 3' ||||||||||||||||||||||||| 3' TACCCTCGGTCTCTACTGCTTATGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold39437:168098-168122 25/25 Antisense off-target Xelaev16049921m
Scaffold54274:3964161-3964185 25/25 Antisense target rab11b.1.S
Scaffold14008:478772-478796 21/25 Sense off-target fnbp1.L
tropicalis 7.1 scaffold_1:125097444-125097468 25/25 Antisense target rab11b.1
Publications
First: Evolutionarily repurposed networks reveal the well-known antifungal drug thiabendazole to be a novel vascular disrupting agent. [PLoS Biol 2012]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556