Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310749

Morpholino Name: fgf20 MO1
Synonyms:
mRNA Target: fgf20

Morpholino Type: splice blocking morpholino
Sequence:
5' GGCAGCGATACGTACCAAAGCGGCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: Amputation-induced reactive oxygen species are required for successful Xenopus tadpole tail regeneration., Nat Cell Biol 2013          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.2


Major funding for Xenbase is provided by grant P41 HD064556