Please note upcoming maintenance times for Xenbase - times are EST:

Wednesday 12-Dec-2018 before noon: BLAST, FTP (Xenbase will be partially functional)
Thursday 13-Dec-2018 before noon: Wiki, GBrowse, JBrowse (Xenbase will be partially functional)
Friday 14-Dec-2018 starting at 5 pm through weekend: Xenbase site and database (Xenbase will be completely down)

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310749

Morpholino Name: fgf20 MO1
Synonyms:
mRNA Target: fgf20

Morpholino Type:
Sequence:
5' GGCAGCGATACGTACCAAAGCGGCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: Amputation-induced reactive oxygen species are required for successful Xenopus tadpole tail regeneration., Nat Cell Biol 2013          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.0


Major funding for Xenbase is provided by grant P41 HD064556