Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310753

Morpholino Name: myod1 MO3
Synonyms: moMyoD1a
mRNA Target: myod1

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' GGCAAGAGCTCCATAGAAACAGCCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' CGGCTGTTTCTATGGAGCTCTTGCC 3' ||||||||||||||||||||||||| 3' GCCGACAAAGATACCTCGAGAACGG 5' 5' GCGCTGTTTCTATGGAGCTGTTGCC 3' ||||||||||||||||| ||||| 3' GCCGACAAAGATACCTCGAGAACGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold47091:1691187..1691211 25/25 Antisense target myod1.L
Scaffold93786:273649..273673 22/25 Antisense target myod1.S
Publications
First: Mef2d acts upstream of muscle identity genes and couples lateral myogenesis to dermomyotome formation in Xenopus laevis., PLoS One 2012                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556