Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310756

Morpholino Name: myod1 MO6
Synonyms: moMyoD2b
Target mRNA: myod1

Morpholino Type: uncategorized morpholino
Sequence: 5' CAAAGTCACTACTCCCAGCGAAGGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACCTTCGCTGGGAGTAGTGACTTTG 3' ||||||||||||||||||||||||| 3' TGGAAGCGACCCTCATCACTGAAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:22717258..22717282 25/25 Antisense target myod1.S
tropicalis 10.0 Chr4:121937489..121937513 21/25 Antisense off-target galr3
Publications
First: Mef2d acts upstream of muscle identity genes and couples lateral myogenesis to dermomyotome formation in Xenopus laevis., PLoS One 2012                    
Most recent:
View All Papers