Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310757

Morpholino Name: myf6 MO1
Synonyms: moMRF4-1
Target mRNA: myf6

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' ATAGGTCCATCATTATGCTTTGCCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GGGCAAAGCATAATGATGGACCTAT 3' ||||||||||||||||||||||||| 3' CCCGTTTCGTATTACTACCTGGATA 5' 5' GGGCAAAGCATAATGATGGACCTAT 3' ||||||||||||||||||||||||| 3' CCCGTTTCGTATTACTACCTGGATA 5' 5' GGGCAAAGCATAATGATGGACCTAT 3' ||||||||||||||||||||||||| 3' CCCGTTTCGTATTACTACCTGGATA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:45217959..45217983 25/25 Antisense target myf6.L
chr3S:93032273..93032297 25/25 Antisense target myf6.S
chr1L:135453953..135453977 22/25 Sense off-target cntnap4.L
chr2S:120348989..120349013 21/25 Antisense off-target ikzf4.S
tropicalis 10.0 Chr3:52532826..52532850 25/25 Antisense target myf6
Chr6:113925375..113925399 22/25 Antisense off-target sntg1
Publications
First:
Most recent:
View All Papers