Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310758

Morpholino Name: myf6 MO2
Synonyms: moMRF4-2
Target mRNA: myf6

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' AGCTAAGTGGCGTGCTCAAAACAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genomic

MO
5' GCTGTTTTGAGCACGCCACTTAGTC 3' ||||||||||||||||||||||| 3' CGACAAAACTCGTGCGGTGAATCGA 5' 5' GCTGTTTTGAGCACGCCACTTAGCT 3' ||||||||||||||||||||||||| 3' CGACAAAACTCGTGCGGTGAATCGA 5' 5' GCTGTTTTGAGCACGCCACTTAGCT 3' ||||||||||||||||||||||||| 3' CGACAAAACTCGTGCGGTGAATCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:45217915..45217939 25/25 Antisense target myf6.L
chr3S:93032317..93032341 25/25 Antisense target myf6.S
tropicalis 10.0 Chr3:52532782..52532806 23/25 Antisense target myf6
Publications
First: Mef2d acts upstream of muscle identity genes and couples lateral myogenesis to dermomyotome formation in Xenopus laevis., PLoS One 2012                    
Most recent:
View All Papers