Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310759

Morpholino Name: mef2d MO3
Synonyms: moMEF2D1a
mRNA Target: mef2d

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' ATCCTCACTGACCAGCGGAGACCTTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold26819:2514187..2514212 25/26 Antisense off-target Xelaev16036267m
Scaffold69901:34258..34283 24/26 unknown
Scaffold105005:69984..70009 23/26 unknown
Scaffold120274:735..760 23/26 unknown
Scaffold137507:262063..262088 23/26 unknown
Scaffold276021:103..128 23/26 unknown
Scaffold2841:39862..39887 23/26 Antisense off-target Xelaev16038477m
Scaffold28814:228312..228337 23/26 unknown
Scaffold386493:8..33 23/26 unknown
Scaffold408520:503..528 23/26 unknown
Scaffold58878:1662905..1662930 23/26 Sense off-target ptpn13.L
Scaffold62432:469287..469312 23/26 unknown
Scaffold67463:183503..183528 23/26 Antisense off-target Xelaev16068009m
Scaffold80536:930871..930896 23/26 unknown
Scaffold83691:230313..230338 23/26 unknown
Scaffold137879:1274318..1274343 22/26 Sense off-target Xelaev16011774m
Scaffold21370:30631..30656 22/26 Antisense off-target Xelaev16027422m
Scaffold232221:385886..385911 22/26 unknown
Scaffold303743:474979..475004 22/26 Sense off-target Xelaev16040912m
Scaffold88938:631642..631667 22/26 unknown
Scaffold94854:245416..245441 22/26 unknown
Publications
First: Mef2d Acts Upstream of Muscle Identity Genes and Couples Lateral Myogenesis to Dermomyotome Formation in Xenopus laevis., PLoS One 2012                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556