Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310760

Morpholino Name: mef2d MO4
Synonyms: moMEF2D1b
mRNA Target: mef2d

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' ATCCTCACCGACCAGCGAAGACCTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' AAGGTCTTCGCTGGTCGGTGAGGAT 3' ||||||||||||||||||||||||| 3' TTCCAGAAGCGACCAGCCACTCCTA 5' 5' AAGGTCTTCGCTGGTCGGTGAGGAT 3' ||||||||||||||||||||||||| 3' TTCCAGAAGCGACCAGCCACTCCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold41091:2864585..2864609 25/25 Antisense target mef2d.S
tropicalis 7.1 scaffold_27:108162..108186 25/25 Antisense target mef2d
Publications
First: Mef2d Acts Upstream of Muscle Identity Genes and Couples Lateral Myogenesis to Dermomyotome Formation in Xenopus laevis., PLoS One 2012                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556