Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310765

Morpholino Name: meox2 MO1
Synonyms: momeox2-1
Target mRNA: meox2

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' CAGGCTTGAGATTCTGGCAGGATTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' TAATCCTGCCAGAATCTCAAGCCTG 3' ||||||||||||||||||||||||| 3' ATTAGGACGGTCTTAGAGTTCGGAC 5' 5' TAATCCTGCCAGAATCTCAAGCCTG 3' ||||||||||||||||||||||||| 3' ATTAGGACGGTCTTAGAGTTCGGAC 5' 5' TAATCCTGCCAGAATCTCAAGCCTG 3' ||||||||||||||||||||||||| 3' ATTAGGACGGTCTTAGAGTTCGGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:34590734..34590758 25/25 Antisense target meox2.L
chr6S:29017889..29017913 25/25 Antisense target meox2.S
chr1L:46236174..46236198 21/25 unknown
tropicalis 10.0 Chr6:36893759..36893783 25/25 Antisense target meox2
Publications
First: Mef2d acts upstream of muscle identity genes and couples lateral myogenesis to dermomyotome formation in Xenopus laevis., PLoS One 2012                    
Most recent: Xenopus SOX5 enhances myogenic transcription indirectly through transrepression., Dev Biol 2018                      
View All Papers