Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310766

Morpholino Name: meox2 MO2
Synonyms: momeox2-2
Target mRNA: meox2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GTGTGTGTTCCATGGCATGCAAGTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' AACTTGTATGCCATGGAACACACAC 3' |||||| |||||||||||||||||| 3' TTGAACGTACGGTACCTTGTGTGTG 5' 5' AACTTGCATGCCATGGAACACACAC 3' ||||||||||||||||||||||||| 3' TTGAACGTACGGTACCTTGTGTGTG 5' 5' AACTTGCATGCCATGGAACACACAC 3' ||||||||||||||||||||||||| 3' TTGAACGTACGGTACCTTGTGTGTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:34590701..34590725 25/25 Antisense target meox2.L
chr6S:29017856..29017880 25/25 Antisense target meox2.S
tropicalis 10.0 Chr6:36893726..36893750 24/25 Antisense target meox2
Chr1:35494925..35494949 21/25 Sense off-target tbc1d1
Chr1:40298561..40298585 21/25 Sense off-target kdr
Chr3:87868508..87868532 21/25 unknown
Publications
First: Mef2d acts upstream of muscle identity genes and couples lateral myogenesis to dermomyotome formation in Xenopus laevis., PLoS One 2012                    
Most recent: Xenopus SOX5 enhances myogenic transcription indirectly through transrepression., Dev Biol 2018                      
View All Papers