Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310768

Morpholino Name: tbxt MO3
Synonyms: TGas116l23, Xbra MO2, Xtbra.2
mRNA Target: tbxt

Morpholino Type: uncategorized morpholino
Sequence:
5' GGCTTCCAAGCGCACACACTGGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

MO
5' CCCAGTGTGTGCGCTTGGAAGCC 3' ||||||||||||||||||||||| 3' GGGTCACACACGCGAACCTTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold166605:387370..387392 19/23 unknown
Scaffold352511:1225523..1225545 19/23 unknown
Scaffold36864:3850426..3850448 19/23 Sense off-target Xelaev16047988m
tropicalis 7.1 scaffold_5:72055043..72055065 23/23 Antisense target t
scaffold_8:88595626..88595648 20/23 unknown
scaffold_1251:11947..11969 19/23 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556