Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310768

Morpholino Name: t MO3
Synonyms: TGas116l23, Xbra MO2, Xtbra.2
mRNA Target: t

Morpholino Type:
Sequence:
5' GGCTTCCAAGCGCACACACTGGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

MO
5' CCCAGTGTGTGCGCTTGGAAGCC 3' ||||||||||||||||||||||| 3' GGGTCACACACGCGAACCTTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold166605:387370-387392 19/23 unknown
Scaffold352511:1225523-1225545 19/23 unknown
Scaffold36864:3850426-3850448 19/23 Sense off-target Xelaev16047988m
tropicalis 7.1 scaffold_5:72055043-72055065 23/23 Antisense target t
scaffold_8:88595626-88595648 20/23 unknown
scaffold_1251:11947-11969 19/23 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent: High-resolution analysis of gene activity during the Xenopus mid-blastula transition. [Development 2014]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556