Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310769

Morpholino Name: t2 MO2
Synonyms: Xbra3 MO1
mRNA Target: t2

Morpholino Type:
Sequence:
5' GAAAGGTCCATATTCTCTTACCTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAAGGTAAGAGAATATGGACCTTTC 3' ||||||||||||||||||||||||| 3' CTTCCATTCTCTTATACCTGGAAAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold11063:262110-262134 21/25 Antisense off-target kcnk5.S
Scaffold161503:2574536-2574560 21/25 unknown
tropicalis 7.1 scaffold_5:72092094-72092118 25/25 Antisense target t2
scaffold_3342:2937-2961 21/25 Antisense off-target kcnk5
Publications
First: In vivo T-box transcription factor profiling reveals joint regulation of embryonic neuromesodermal bipotency. [Cell Rep 2013]
Most recent: High-resolution analysis of gene activity during the Xenopus mid-blastula transition. [Development 2014]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556