Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310770

Morpholino Name: t2 MO3
Synonyms: Bra3, TNeu061i04, Xbra3 MO2, XtBra3
mRNA Target: t2

Morpholino Type:
Sequence:
5' AGCTGTGCCTGTGCTCATTGTATTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CAATACAATGAGCACAGGCACAGCT 3' ||||||||||||||||||||||||| 3' GTTATGTTACTCGTGTCCGTGTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold330256:55193..55217 23/25 Antisense off-target Xelaev16043830m
Scaffold14467:529485..529509 22/25 Antisense off-target Xelaev16013079m
Scaffold27036:3449233..3449257 22/25 Sense off-target Xelaev16036516m
Scaffold54140:949702..949726 21/25 unknown
tropicalis 7.1 scaffold_5:72091885..72091909 25/25 Antisense target t2
scaffold_1:40495521..40495545 21/25 unknown
scaffold_7:62036525..62036549 21/25 unknown
scaffold_8:4859283..4859307 21/25 Sense off-target tsc1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent: Innate Immune Response and Off-Target Mis-splicing Are Common Morpholino-Induced Side Effects in Xenopus. [Dev Cell 2018]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556