Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310775

Morpholino Name: lef1 MO5
Synonyms: XtLEF1 MOex8
mRNA Target: lef1

Morpholino Type:
Sequence:
5' TCCTACTACTTACCCTTCTACCCAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' CTGGGTAGAAGGGTAAGTAGTAGGA 3' ||||||||||||||||||||||||| 3' GACCCATCTTCCCATTCATCATCCT 5' 5' CTGGGAAGGAGGGTAAGTAGTAGAA 3' ||||| || |||||||||||||| | 3' GACCCATCTTCCCATTCATCATCCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold81573:103430-103454 22/25 Antisense off-target Xelaev16074861m
Scaffold88765:3420452-3420476 22/25 Antisense target lef1.L
Scaffold315413:944126-944150 21/25 Antisense off-target Xelaev16042252m
tropicalis 7.1 scaffold_1:155817418-155817442 25/25 Antisense target lef1
scaffold_263:34820-34844 21/25 unknown
scaffold_4:132426243-132426267 21/25 Antisense off-target lrig1
scaffold_8:106739915-106739939 21/25 unknown
Publications
First: Design and use of transgenic reporter strains for detecting activity of signaling pathways in Xenopus. [Methods 2014]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556