Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310798

Morpholino Name: vegfa MO4
Synonyms:
mRNA Target: vegfa

Morpholino Type: uncategorized morpholino
Sequence:
5' TGGCCTTTTAGTACTTGAAAGACGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_1:46380296..46380320 21/25 Antisense off-target kntc1
scaffold_9:66228979..66229003 21/25 Sense off-target kctd5
Publications
First: Expression and localization of Rdd proteins in Xenopus embryo., Anat Cell Biol 2014            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556