Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310800

Morpholino Name: ccno MO1
Synonyms:
mRNA Target: ccno

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' ATCTCATGCTGCAGGTCACCATGTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' AACATGGTGACCTGTAGCATGAGAT 3' |||||||||||||| |||||||||| 3' TTGTACCACTGGACGTCGTACTCTA 5' 5' AACATGGTGACCTGTAGCATGAGAT 3' |||||||||||||| |||||||||| 3' TTGTACCACTGGACGTCGTACTCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold337825:4727856..4727880 25/25 Antisense off-target Xelaev16044522m
Scaffold52441:12610598..12610622 24/25 Antisense target ccno.L
Scaffold208071:8631661..8631685 22/25 Antisense off-target Xelaev16027120m
Scaffold122663:2079482..2079506 21/25 Sense off-target Xelaev16006263m
Scaffold9266:10322909..10322933 21/25 Antisense off-target Xelaev16078901m
tropicalis 7.1 scaffold_1:9452813..9452837 24/25 Antisense target ccno
Publications
First: Mutations in CCNO result in congenital mucociliary clearance disorder with reduced generation of multiple motile cilia., Nat Genet 2014  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556