Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310816

Morpholino Name: serpine2 MO3
Synonyms: PN1.b-MO
mRNA Target: serpine2

Morpholino Type: uncategorized morpholino
Sequence:
5' CATGATCGTAGAACTGGATAGAAGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold16807:12513021..12513045 25/25 Antisense off-target Xelaev16019699m
Publications
First: The serpin PN1 is a feedback regulator of FGF signaling in germ layer and primary axis formation., Development 2015                                      
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.0


Major funding for Xenbase is provided by grant P41 HD064556