Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310852

Morpholino Name: slc35d1 MO1
Synonyms:
Target mRNA: slc35d1

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' ACGTCTACCGACTTCCGCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/22 22/22
genomic

MO
5' CATGGCGGAAGTCGGTAGACGT 3' |||||||||||||||||||||| 3' GTACCGCCTTCAGCCATCTGCA 5' 5' CATGGCGGAAGTCGGTAGACGT 3' |||||||||||||||||||||| 3' GTACCGCCTTCAGCCATCTGCA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:73155978..73155999 22/22 Antisense target slc35d1.L
chr4S:58252629..58252650 21/22 Antisense off-target LOC108715520 [provisional:slc35d2]
tropicalis 10.0 Chr4:83717734..83717755 22/22 Antisense target slc35d1
Publications
First: Molecular asymmetry in the 8-cell stage Xenopus tropicalis embryo described by single blastomere transcript sequencing., Dev Biol 2015            
Most recent:
View All Papers