Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17310873

Morpholino Name: jmjd6 MO1
Synonyms:
mRNA Target: jmjd6

Morpholino Type: Translation Blocking(ATG)
Sequence:
5' TGCGCTTCTTACTCTTGTGGTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGAACCACAAGAGTAAGAAGCGCA 3' ||||||||||||||||||||||||| 3' TACTTGGTGTTCTCATTCTTCGCGT 5' 5' ATGAACCACAAGAGTAAGAAGCGCA 3' ||||||||||||||||||||||||| 3' TACTTGGTGTTCTCATTCTTCGCGT 5' 5' ATGAACCACAAGAGTAAGAAGCGCA 3' ||||||||||||||||||||||||| 3' TACTTGGTGTTCTCATTCTTCGCGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold106323:682351-682375 25/25 Antisense target jmjd6.S
Scaffold71264:142161-142185 25/25 Antisense target jmjd6.L
Scaffold8355:769747-769771 21/25 unknown
tropicalis 7.1 scaffold_10:3579083-3579107 25/25 Antisense target jmjd6
Publications
First: JmjC Domain-containing Protein 6 (Jmjd6) Derepresses the Transcriptional Repressor Transcription Factor 7-like 1 (Tcf7l1) and Is Required for Body Axis Patterning during Xenopus Embryogenesis. [J Biol Chem 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556