Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311101

Morpholino Name: Tubz1 MO1
Synonyms: Zeta MO1
mRNA Target: tubz1

Morpholino Type: translation blocking morpholino
Sequence:
5' CCACCTGGAGCCAAACCAACGACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold44271:272..296 25/25 unknown
tropicalis 10.0 Chr1:170763925..170763949 21/25 Sense off-target dtwd2
Chr6:41015300..41015324 21/25 Antisense off-target osbpl3
Publications
First: Zeta-Tubulin Is a Member of a Conserved Tubulin Module and Is a Component of the Centriolar Basal Foot in Multiciliated Cells., Curr Biol 2015                
Most recent:
View All Papers