Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311103

Morpholino Name: Tubz1 MO3
Synonyms: Zeta MO3
Target mRNA: tubz1

Morpholino Type: splice blocking morpholino
Sequence: 5' TACCTAAGGAGGAAGTAACAGGACT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGTCCTGTTACTTCCTCCTTAGGTA 3' ||||||||||||||||||||||||| 3' TCAGGACAATGAAGGAGGAATCCAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:4013900..4013924 25/25 Antisense target tubz1.L
chr2S:5639907..5639931 21/25 Antisense off-target slc6a4.S
Publications
First: Zeta-Tubulin Is a Member of a Conserved Tubulin Module and Is a Component of the Centriolar Basal Foot in Multiciliated Cells., Curr Biol 2015                
Most recent:
View All Papers