Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311121

Morpholino Name: cdx1 MO2
Synonyms: Cdx1/Xtcad2 MO
mRNA Target: cdx1

Morpholino Type: uncategorized morpholino
Sequence:
5' CGGGTAACAATCTCCTGAGTCTGTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CACAGACTCAGGAGATTGTTACCCG 3' ||||||||||||||||||||||||| 3' GTGTCTGAGTCCTCTAACAATGGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_3:44788869..44788893 25/25 Antisense target cdx1
Publications
First: Overlapping functions of Cdx1, Cdx2, and Cdx4 in the development of the amphibian Xenopus tropicalis., Dev Dyn 2009                                  
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.2


Major funding for Xenbase is provided by grant P41 HD064556