Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311171

Morpholino Name: vangl1 MO2
Synonyms: vangl1 MO
mRNA Target: vangl1

Morpholino Type:
Sequence:
5' TTGGATTCCGTGTCCATATCTGGTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' CTACAGATATGGACACGGAATCCAA 3' |||||||||||||||||||||| 3' TTGGTCTATACCTGTGCCTTAGGTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold169011:591269-591293 22/25 Antisense target vangl1.L
Scaffold347078:776540-776564 21/25 Antisense off-target Xelaev16045713m
Publications
First: Neural crest specification by Prohibitin1 depends on transcriptional regulation of prl3 and vangl1. [Genesis 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556