Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311237

Morpholino Name: aurka MO1
Synonyms: Aurora A, TEgg021k02, XtAuroraA
mRNA Target: aurka

Morpholino Type:
Sequence:
5' CTTTAACAGCCCGTTCCATTATATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATATAATGGAACGGGCTGTTAAAG 3' ||||||||||||||||||||||||| 3' GTATATTACCTTGCCCGACAATTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14557:2189112..2189136 22/25 Antisense off-target Xelaev16013234m
Scaffold298452:157600..157624 22/25 Antisense off-target Xelaev16039929m
Scaffold256647:1528189..1528213 21/25 unknown
tropicalis 7.1 scaffold_10:35503359..35503383 25/25 Antisense target aurka
scaffold_1:202174966..202174990 21/25 unknown
scaffold_1:202186199..202186223 21/25 unknown
scaffold_1:202189327..202189351 21/25 unknown
scaffold_1:202192952..202192976 21/25 unknown
scaffold_1:202196176..202196200 21/25 unknown
scaffold_1:202199986..202200010 21/25 unknown
scaffold_1:202206160..202206184 21/25 unknown
scaffold_1:44883535..44883559 21/25 Antisense off-target sh2b3
scaffold_1311:12011..12035 21/25 unknown
scaffold_1311:1908..1932 21/25 unknown
scaffold_1311:5444..5468 21/25 unknown
scaffold_2540:2055..2079 21/25 unknown
scaffold_2540:539..563 21/25 unknown
scaffold_2540:6366..6390 21/25 unknown
scaffold_3:26208444..26208468 21/25 unknown
scaffold_3127:3512..3536 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556