Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311237

Morpholino Name: aurka MO1
Synonyms: Aurora A, TEgg021k02, XtAuroraA
Target mRNA: aurka

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTTAACAGCCCGTTCCATTATATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' CATATAATGGAACGGGCTGTTAAAG 3' ||||||||||||||||||||||||| 3' GTATATTACCTTGCCCGACAATTTC 5' 5' TACATAATGGAGCGGGCTGTTAAAG 3' | |||||||| ||||||||||||| 3' GTATATTACCTTGCCCGACAATTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10S:12064780..12064804 22/25 Antisense target aurka.S
chr4S:95324514..95324538 22/25 Antisense off-target tptep2-csnk1e.S
chr3S:6792086..6792110 21/25 unknown
tropicalis 10.0 Chr10:6090968..6090992 25/25 Antisense target aurka
Chr1:163190162..163190186 21/25 Antisense off-target sh2b3
Chr1:17752522..17752546 21/25 Antisense off-target Xetrov107000399m.g
Chr1:17757617..17757641 21/25 Antisense off-target Xetrov107000399m.g
Chr1:17762156..17762180 21/25 Antisense off-target Xetrov107000399m.g
Chr1:17769292..17769316 21/25 Antisense off-target Xetrov107000399m.g
Chr1:17772496..17772520 21/25 Antisense off-target Xetrov107000399m.g
Chr1:17777408..17777432 21/25 Antisense off-target Xetrov107000399m.g
Chr1:17780613..17780637 21/25 Antisense off-target Xetrov107000399m.g
Chr1:17749393..17749417 21/25 Antisense off-target Xetrov107000399m.g
Chr1:17730269..17730293 21/25 unknown
Chr1:17736571..17736595 21/25 unknown
Chr1:17740221..17740245 21/25 unknown
Chr1:17743354..17743378 21/25 unknown
Chr1:17746374..17746398 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers