Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311239

Morpholino Name: prdm1 MO1
Synonyms: Blimp1, TGas049g17, XtBlimp1
mRNA Target: prdm1

Morpholino Type:
Sequence:
5' ATTCCTTCCATATCCATTTTCATTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CAATGAAAATGGATATGGAAGGAAT 3' ||||||||||||||||||||||||| 3' GTTACTTTTACCTATACCTTCCTTA 5' 5' CAATGAAAATGGATATGGAAGGAAT 3' ||||||||||||||||||||||||| 3' GTTACTTTTACCTATACCTTCCTTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold8355:3061106-3061130 25/25 Antisense target prdm1.S
Scaffold8630:3741131-3741155 25/25 Antisense off-target Xelaev16076443m
Scaffold43061:6864855-6864879 22/25 unknown
Scaffold12879:5375285-5375309 21/25 Antisense off-target epb41l4a.S
Scaffold136959:362496-362520 21/25 Antisense off-target Xelaev16011170m
Scaffold20750:49-73 21/25 unknown
Scaffold3732:31954-31978 21/25 unknown
Scaffold81122:534036-534060 21/25 Sense off-target Xelaev16074434m
tropicalis 7.1 scaffold_5:48173421-48173445 25/25 Antisense target prdm1
scaffold_8:5697463-5697487 22/25 unknown
scaffold_1:175049516-175049540 21/25 Antisense off-target galntl6
scaffold_10:18686338-18686362 21/25 unknown
scaffold_2:57381305-57381329 21/25 Antisense off-target slc5a7
scaffold_4:57098733-57098757 21/25 unknown
scaffold_42:320629-320653 21/25 unknown
scaffold_6:67230525-67230549 21/25 unknown
scaffold_8:18081838-18081862 21/25 Sense off-target stim2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556