Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311246

Morpholino Name: zmynd11 MO1
Synonyms: CX843311, XtBS69
mRNA Target: zmynd11

Morpholino Type:
Sequence:
5' CAATCTGTTTCTGGTTGCGGATTAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GTAATCCGCAACCAGAAACAGATTG 3' ||||||||||||||||||||||||| 3' CATTAGGCGTTGGTCTTTGTCTAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold203041:6324397-6324421 24/25 Antisense off-target Xelaev16026045m
Scaffold52573:8209261-8209285 24/25 Antisense off-target Xelaev16060422m
Scaffold218195:1990776-1990800 22/25 unknown
Scaffold145781:33257-33281 21/25 Antisense off-target appl1.L
Scaffold177844:136343-136367 21/25 Antisense off-target Xelaev16021429m
Scaffold78649:547044-547068 21/25 unknown
tropicalis 7.1 scaffold_6:127634090-127634114 25/25 Antisense target zmynd11
scaffold_4:137490873-137490897 21/25 Antisense off-target appl1
scaffold_5:41774035-41774059 21/25 Sense off-target orc3
scaffold_6:57619895-57619919 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556