Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311251

Morpholino Name: dynll1 MO1
Synonyms: TGas050a15, XtcD2LC, cD2LC
mRNA Target: dynll1

Morpholino Type:
Sequence:
5' GATCACAGCTTTTCTCTCAGACATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' CATGTCTGAGAGAAAAGCTGTGATC 3' ||||||||||||||||||||||||| 3' GTACAGACTCTCTTTTCGACACTAG 5' 5' CATGTCTGAGAGGAAAGCTGTGATC 3' |||||||||||| |||||||||||| 3' GTACAGACTCTCTTTTCGACACTAG 5' 5' CATGTCTGAGAGGAAAGCTGTGATC 3' |||||||||||| |||||||||||| 3' GTACAGACTCTCTTTTCGACACTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold113816:509199-509223 24/25 Antisense target dynll1.S
Scaffold36586:113478-113502 24/25 Antisense target dynll1.L
Scaffold75417:7172074-7172098 21/25 unknown
tropicalis 7.1 scaffold_1:56219150-56219174 25/25 Antisense target dynll1
scaffold_6:12251248-12251272 21/25 unknown
scaffold_8:85917858-85917882 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556