Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311255

Morpholino Name: cdx2 MO2
Synonyms: Cad1, Cdx1, TNeu122o17, Xtcdx-1
mRNA Target: cdx2

Morpholino Type: uncategorized morpholino
Sequence:
5' CTCCAACAAGTAACTCACGTACATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genomic

MO
5' CATGTACGTGAGTTACTTGTTGGAG 3' ||||||||||||||||||||||||| 3' GTACATGCACTCAATGAACAACCTC 5' 5' CATGTACGTGAGTTACTTGTTGGAA 3' |||||||||||||||||||||||| 3' GTACATGCACTCAATGAACAACCTC 5' 5' CATGTACGTGAGTTACTTATTGGAA 3' |||||||||||||||||| ||||| 3' GTACATGCACTCAATGAACAACCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:158714166..158714190 24/25 Antisense target cdx2.L
chr2S:138264730..138264754 23/25 Antisense target cdx2.S
tropicalis 10.0 Chr2:155090213..155090237 25/25 Antisense target cdx2
Chr6:144524883..144524907 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: Overlapping functions of Cdx1, Cdx2, and Cdx4 in the development of the amphibian Xenopus tropicalis., Dev Dyn 2009                                  
View All Papers