Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311257

Morpholino Name: cdx1 MO3
Synonyms: CAD2, Cdx2, TNeu087f10, Xtcdx-2
mRNA Target: cdx1

Morpholino Type:
Sequence:
5' ATCCAAAAGATAACCCACGTACATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GATGTACGTGGGTTATCTTTTGGAT 3' ||||||||||||||||||||||||| 3' CTACATGCACCCAATAGAAAACCTA 5' 5' GATGTACGTGGGTTATCTTTTGGAT 3' ||||||||||||||||||||||||| 3' CTACATGCACCCAATAGAAAACCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold187759:1223086-1223110 25/25 Antisense target cdx1.S
Scaffold69562:110973-110997 25/25 Antisense off-target Xelaev16069075m
Scaffold13941:836316-836340 21/25 Antisense off-target Xelaev16012235m
Scaffold339305:171752-171776 21/25 Sense off-target Xelaev16044769m
Scaffold36600:891011-891035 21/25 unknown
tropicalis 7.1 scaffold_3:44788926-44788950 25/25 Antisense target cdx1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556