Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311263

Morpholino Name: cpsf4 MO1
Synonyms: TGas053l04, Xtcpsf30kDa
mRNA Target: cpsf4

Morpholino Type:
Sequence:
5' CCACACAAGCAATTAACTCCTGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGCAGGAGTTAATTGCTTGTGTGG 3' ||||||||||||||||||||||||| 3' TACGTCCTCAATTAACGAACACACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold120240:2741111..2741135 24/25 Antisense off-target Xelaev16005593m
Scaffold26364:4589494..4589518 24/25 Antisense off-target Xelaev16035379m
Scaffold78302:655720..655744 22/25 unknown
Scaffold12462:2899262..2899286 21/25 unknown
Scaffold124886:4725..4749 21/25 unknown
Scaffold127187:956964..956988 21/25 unknown
Scaffold190777:1149885..1149909 21/25 unknown
Scaffold203041:194062..194086 21/25 Antisense off-target Xelaev16025845m
Scaffold26505:2121482..2121506 21/25 unknown
Scaffold39723:6183440..6183464 21/25 Sense off-target ngb.L
Scaffold44780:90352..90376 21/25 unknown
tropicalis 7.1 scaffold_9:40665058..40665082 25/25 Sense off-target ptcd1
scaffold_9:40665058..40665082 25/25 Antisense target cpsf4
scaffold_6:130236344..130236368 22/25 Sense off-target paxip1
scaffold_4:57863386..57863410 21/25 unknown
scaffold_4:83316201..83316225 21/25 Antisense off-target rangap1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556