Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311268

Morpholino Name: dync2li1 MO2
Synonyms: D2LIC, TNeu059o03, XtD2LIC.2
mRNA Target: dync2li1

Morpholino Type:
Sequence:
5' TCTACAGACTCACAAGAAACCAAAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold180104:210140-210164 21/25 Antisense off-target Xelaev16021900m
tropicalis 7.1 scaffold_1:213738674-213738698 21/25 unknown
scaffold_323:4925-4949 21/25 unknown
scaffold_355:10061-10085 21/25 unknown
scaffold_355:36204-36228 21/25 unknown
scaffold_395:42787-42811 21/25 unknown
scaffold_6:44097421-44097445 21/25 unknown
scaffold_7:97031687-97031711 21/25 unknown
scaffold_729:19556-19580 21/25 unknown
scaffold_823:25395-25419 21/25 unknown
scaffold_9:45681165-45681189 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556