Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311274

Morpholino Name: dmd.2 MO1
Synonyms: Dp427p1, TGas086e13, XtdysDp427p1
mRNA Target: dmd.2

Morpholino Type:
Sequence:
5' TTTCATTGTGTCCGGCTCTCTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold102974:2985068..2985092 22/25 unknown
Scaffold189728:268975..268999 22/25 unknown
Scaffold67738:957257..957281 22/25 unknown
Scaffold106356:85191..85215 21/25 unknown
Scaffold127187:2490444..2490468 21/25 unknown
Scaffold150085:215..239 21/25 unknown
Scaffold190191:671..695 21/25 unknown
Scaffold20641:4538951..4538975 21/25 unknown
Scaffold344163:137..161 21/25 unknown
Scaffold36134:1287386..1287410 21/25 unknown
Scaffold36295:108821..108845 21/25 unknown
Scaffold7103:2463245..2463269 21/25 unknown
tropicalis 7.1 scaffold_1:140909812..140909836 22/25 Sense off-target kdm4b
scaffold_1:140914494..140914518 22/25 Sense off-target kdm4b
scaffold_1:153394209..153394233 22/25 unknown
scaffold_1:16753325..16753349 22/25 unknown
scaffold_1:48443290..48443314 22/25 unknown
scaffold_1:49220294..49220318 22/25 unknown
scaffold_1:49225305..49225329 22/25 unknown
scaffold_1922:7531..7555 22/25 unknown
scaffold_2:48466594..48466618 22/25 unknown
scaffold_2:53555734..53555758 22/25 Antisense off-target otc
scaffold_2:98685376..98685400 22/25 unknown
scaffold_2:98690324..98690348 22/25 unknown
scaffold_3:46563531..46563555 22/25 unknown
scaffold_3b:1168430..1168454 22/25 unknown
scaffold_4:77897666..77897690 22/25 unknown
scaffold_4:77901973..77901997 22/25 unknown
scaffold_4:78091455..78091479 22/25 unknown
scaffold_4:81438905..81438929 22/25 unknown
scaffold_4793:1162..1186 22/25 unknown
scaffold_5:14046313..14046337 22/25 unknown
scaffold_5:25927334..25927358 22/25 unknown
scaffold_5:25938551..25938575 22/25 unknown
scaffold_5:25943611..25943635 22/25 unknown
scaffold_5954:589..613 22/25 unknown
scaffold_6:104380491..104380515 22/25 unknown
scaffold_6:104384272..104384296 22/25 unknown
scaffold_6:141101481..141101505 22/25 unknown
scaffold_6:60813932..60813956 22/25 unknown
scaffold_6:68411536..68411560 22/25 unknown
scaffold_6:68423017..68423041 22/25 unknown
scaffold_652:36485..36509 22/25 unknown
scaffold_7:56895604..56895628 22/25 unknown
scaffold_7:79466925..79466949 22/25 unknown
scaffold_7:79470910..79470934 22/25 unknown
scaffold_8:34104435..34104459 22/25 unknown
scaffold_8:34109499..34109523 22/25 unknown
scaffold_9:6789231..6789255 22/25 unknown
scaffold_1:134806675..134806699 21/25 unknown
scaffold_1:212267940..212267964 21/25 unknown
scaffold_1:27513591..27513615 21/25 unknown
scaffold_10:36594069..36594093 21/25 Antisense off-target cyp24a1
scaffold_1140:9391..9415 21/25 unknown
scaffold_1140:9467..9491 21/25 unknown
scaffold_2:53550359..53550383 21/25 Antisense off-target otc
scaffold_2:63277411..63277435 21/25 unknown
scaffold_2:72639059..72639083 21/25 unknown
scaffold_2:96391937..96391961 21/25 unknown
scaffold_22:595675..595699 21/25 unknown
scaffold_22:599287..599311 21/25 unknown
scaffold_3:55865523..55865547 21/25 unknown
scaffold_4:113921477..113921501 21/25 unknown
scaffold_4:129254982..129255006 21/25 Sense off-target prok2
scaffold_4:33599188..33599212 21/25 unknown
scaffold_4:33603238..33603262 21/25 unknown
scaffold_4:34157148..34157172 21/25 unknown
scaffold_4:34316736..34316760 21/25 unknown
scaffold_4:78006687..78006711 21/25 unknown
scaffold_5:76335294..76335318 21/25 unknown
scaffold_6:13334315..13334339 21/25 unknown
scaffold_6:141096430..141096454 21/25 unknown
scaffold_6:82080004..82080028 21/25 unknown
scaffold_6347:2450..2474 21/25 unknown
scaffold_7:39131351..39131375 21/25 unknown
scaffold_7:72189136..72189160 21/25 unknown
scaffold_7:74431362..74431386 21/25 unknown
scaffold_7:74436815..74436839 21/25 unknown
scaffold_7:77123825..77123849 21/25 unknown
scaffold_7:77129393..77129417 21/25 unknown
scaffold_70:154921..154945 21/25 unknown
scaffold_8:19279004..19279028 21/25 unknown
scaffold_8:3828778..3828802 21/25 unknown
scaffold_8:65069107..65069131 21/25 unknown
scaffold_8:68792486..68792510 21/25 unknown
scaffold_84:114383..114407 21/25 Antisense off-target b3gnt3
scaffold_85:184811..184835 21/25 unknown
scaffold_89:205512..205536 21/25 unknown
scaffold_9:52520835..52520859 21/25 unknown
scaffold_9:52840089..52840113 21/25 unknown
scaffold_9:52845119..52845143 21/25 unknown
scaffold_9:59869418..59869442 21/25 Antisense off-target hba-l5
scaffold_99:251428..251452 21/25 Antisense off-target mhc1a
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556