Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311274

Morpholino Name: dmd.2 MO1
Synonyms: Dp427p1, TGas086e13, XtdysDp427p1
mRNA Target: dmd.2

Morpholino Type:
Sequence:
5' TTTCATTGTGTCCGGCTCTCTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold102974:2985068-2985092 22/25 unknown
Scaffold189728:268975-268999 22/25 unknown
Scaffold67738:957257-957281 22/25 unknown
Scaffold106356:85191-85215 21/25 unknown
Scaffold127187:2490444-2490468 21/25 unknown
Scaffold150085:215-239 21/25 unknown
Scaffold190191:671-695 21/25 unknown
Scaffold20641:4538951-4538975 21/25 unknown
Scaffold344163:137-161 21/25 unknown
Scaffold36134:1287386-1287410 21/25 unknown
Scaffold36295:108821-108845 21/25 unknown
Scaffold7103:2463245-2463269 21/25 unknown
tropicalis 7.1 scaffold_1:140909812-140909836 22/25 Sense off-target kdm4b
scaffold_1:140914494-140914518 22/25 Sense off-target kdm4b
scaffold_1:153394209-153394233 22/25 unknown
scaffold_1:16753325-16753349 22/25 unknown
scaffold_1:48443290-48443314 22/25 unknown
scaffold_1:49220294-49220318 22/25 unknown
scaffold_1:49225305-49225329 22/25 unknown
scaffold_1922:7531-7555 22/25 unknown
scaffold_2:48466594-48466618 22/25 unknown
scaffold_2:53555734-53555758 22/25 Antisense off-target otc
scaffold_2:98685376-98685400 22/25 unknown
scaffold_2:98690324-98690348 22/25 unknown
scaffold_3:46563531-46563555 22/25 unknown
scaffold_3b:1168430-1168454 22/25 unknown
scaffold_4:77897666-77897690 22/25 unknown
scaffold_4:77901973-77901997 22/25 unknown
scaffold_4:78091455-78091479 22/25 unknown
scaffold_4:81438905-81438929 22/25 unknown
scaffold_4793:1162-1186 22/25 unknown
scaffold_5:14046313-14046337 22/25 unknown
scaffold_5:25927334-25927358 22/25 unknown
scaffold_5:25938551-25938575 22/25 unknown
scaffold_5:25943611-25943635 22/25 unknown
scaffold_5954:589-613 22/25 unknown
scaffold_6:104380491-104380515 22/25 unknown
scaffold_6:104384272-104384296 22/25 unknown
scaffold_6:141101481-141101505 22/25 unknown
scaffold_6:60813932-60813956 22/25 unknown
scaffold_6:68411536-68411560 22/25 unknown
scaffold_6:68423017-68423041 22/25 unknown
scaffold_652:36485-36509 22/25 unknown
scaffold_7:56895604-56895628 22/25 unknown
scaffold_7:79466925-79466949 22/25 unknown
scaffold_7:79470910-79470934 22/25 unknown
scaffold_8:34104435-34104459 22/25 unknown
scaffold_8:34109499-34109523 22/25 unknown
scaffold_9:6789231-6789255 22/25 unknown
scaffold_1:134806675-134806699 21/25 unknown
scaffold_1:212267940-212267964 21/25 unknown
scaffold_1:27513591-27513615 21/25 unknown
scaffold_10:36594069-36594093 21/25 Antisense off-target cyp24a1
scaffold_1140:9391-9415 21/25 unknown
scaffold_1140:9467-9491 21/25 unknown
scaffold_2:53550359-53550383 21/25 Antisense off-target otc
scaffold_2:63277411-63277435 21/25 unknown
scaffold_2:72639059-72639083 21/25 unknown
scaffold_2:96391937-96391961 21/25 unknown
scaffold_22:595675-595699 21/25 unknown
scaffold_22:599287-599311 21/25 unknown
scaffold_3:55865523-55865547 21/25 unknown
scaffold_4:113921477-113921501 21/25 unknown
scaffold_4:129254982-129255006 21/25 Sense off-target prok2
scaffold_4:33599188-33599212 21/25 unknown
scaffold_4:33603238-33603262 21/25 unknown
scaffold_4:34157148-34157172 21/25 unknown
scaffold_4:34316736-34316760 21/25 unknown
scaffold_4:78006687-78006711 21/25 unknown
scaffold_5:76335294-76335318 21/25 unknown
scaffold_6:13334315-13334339 21/25 unknown
scaffold_6:141096430-141096454 21/25 unknown
scaffold_6:82080004-82080028 21/25 unknown
scaffold_6347:2450-2474 21/25 unknown
scaffold_7:39131351-39131375 21/25 unknown
scaffold_7:72189136-72189160 21/25 unknown
scaffold_7:74431362-74431386 21/25 unknown
scaffold_7:74436815-74436839 21/25 unknown
scaffold_7:77123825-77123849 21/25 unknown
scaffold_7:77129393-77129417 21/25 unknown
scaffold_70:154921-154945 21/25 unknown
scaffold_8:19279004-19279028 21/25 unknown
scaffold_8:3828778-3828802 21/25 unknown
scaffold_8:65069107-65069131 21/25 unknown
scaffold_8:68792486-68792510 21/25 unknown
scaffold_84:114383-114407 21/25 Antisense off-target b3gnt3
scaffold_85:184811-184835 21/25 unknown
scaffold_89:205512-205536 21/25 unknown
scaffold_9:52520835-52520859 21/25 unknown
scaffold_9:52840089-52840113 21/25 unknown
scaffold_9:52845119-52845143 21/25 unknown
scaffold_9:59869418-59869442 21/25 Antisense off-target hba-l5
scaffold_99:251428-251452 21/25 Antisense off-target mhc1a
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556