Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311276

Morpholino Name: dmd.1 MO1
Synonyms: Dp71, TNeu143c03, XtdysDp71/40
mRNA Target: dmd.1

Morpholino Type:
Sequence:
5' ATGGCCTTTCAGCAGCTCCCTCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 21/25
genomic

MO
5' CATGAGGGAGCTGCTGAAAGGGTGA 3' ||||||||||||||||||||| 3' GTACTCCCTCGACGACTTTCCGGTA 5' 5' CATGAGGGAGCTGCTGAAAGGGTGA 3' ||||||||||||||||||||| 3' GTACTCCCTCGACGACTTTCCGGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold17127:5722843..5722867 21/25 Antisense target dmd.1.L
Scaffold2049:1133231..1133255 21/25 Antisense off-target elmod2.L
Scaffold78302:3647479..3647503 21/25 Antisense off-target Xelaev16073007m
tropicalis 7.1 scaffold_2:49341225..49341249 21/25 Antisense target dmd.1
scaffold_9:47577362..47577386 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556