Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311280

Morpholino Name: eomes MO3
Synonyms: TGas141f06, XtEomes
Target mRNA: eomes

Morpholino Type: uncategorized morpholino
Sequence: 5' GTAAATAAGGAGCGCCAAGCACCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGTGCTTGGCGCTCCTTATTTAC 3' ||||||||||||||||||||||||| 3' TACCACGAACCGCGAGGAATAAATG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:173839530..173839554 22/25 Sense off-target LOC108705483 [provisional:dym]
chr7L:39378402..39378426 21/25 unknown
tropicalis 10.0 Chr6:48273740..48273764 25/25 Antisense target eomes
Chr8:110940208..110940232 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers