Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311281

Morpholino Name: eomes MO4
Synonyms: TGas141f06, XtEomes.2
mRNA Target: eomes

Morpholino Type:
Sequence:
5' GGCTTCACTTACACACAGGAAGGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' CCCTTCCTGTGTGTAAGTGAAGCC 3' |||||||||||||||||||||||| 3' GGGAAGGACACACATTCACTTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold48114:951490-951513 22/24 Antisense off-target Xelaev16057486m
Scaffold69258:1513677-1513700 21/24 Antisense off-target eomes.S
Scaffold22415:4887863-4887886 20/24 Sense off-target Xelaev16029307m
Scaffold30470:5582680-5582703 20/24 Antisense off-target Xelaev16041157m
Scaffold58790:119197-119220 20/24 Sense off-target washc1.L
tropicalis 7.1 scaffold_6:97450639-97450662 24/24 Antisense target eomes
scaffold_6:32838921-32838944 21/24 unknown
scaffold_1:141100920-141100943 20/24 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556