Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311281

Morpholino Name: eomes MO4
Synonyms: TGas141f06, XtEomes.2
Target mRNA: eomes

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCTTCACTTACACACAGGAAGGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24 22/24 21/24
genomic

MO
5' CCCTTCCTGTGTGTAAGTGAAGCC 3' |||||||||||||||||||||||| 3' GGGAAGGACACACATTCACTTCGG 5' 5' CCCTCCCCGTGTGTAAGTGAAGCC 3' |||| || |||||||||||||||| 3' GGGAAGGACACACATTCACTTCGG 5' 5' TCCTTCCTGAGAGTAAGTGAAGCC 3' |||||||| | |||||||||||| 3' GGGAAGGACACACATTCACTTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:46155312..46155335 22/24 Antisense target eomes.L
chr6S:39835121..39835144 21/24 Antisense target eomes.S
Scaffold39:497861..497884 20/24 Sense off-target washc1.L
chr6L:13479178..13479201 20/24 Sense off-target lmbr1.L
chr3L:54112160..54112183 20/24 unknown
tropicalis 10.0 Chr6:48273774..48273797 24/24 Antisense target eomes
Chr1:91325145..91325168 20/24 Sense off-target kdm4b
Chr6:116925937..116925960 21/24 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers