Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311283

Morpholino Name: loc733728 MO1
Synonyms: TEgg055b18, XtETGF
mRNA Target: loc733728

Morpholino Type:
Sequence:
5' GTTTAACATCGCACAAATGGAACCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold181837:1342242-1342266 21/25 Sense off-target Xelaev16022114m
tropicalis 7.1 scaffold_7:38643306-38643330 24/25 Antisense off-target loc733728
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556