Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311284

Morpholino Name: ext1 MO2
Synonyms: Exostosin 1, TEgg033o10, XtExostosin-1
mRNA Target: ext1

Morpholino Type:
Sequence:
5' TGCATGTGTCCGGTCAGGGTGCTAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold264180:493369..493393 24/25 Antisense off-target Xelaev16035461m
Scaffold312531:342206..342230 23/25 Antisense off-target Xelaev16041902m
tropicalis 7.1 scaffold_6:11375741..11375765 24/25 unknown
scaffold_3b:2339076..2339100 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556