Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311287

Morpholino Name: fgfr3 MO2
Synonyms: TGas092f08, XtFgfr3-2, cek2
mRNA Target: fgfr3

Morpholino Type:
Sequence:
5' TGCAGAACAGGGTGACCATTCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' ATGGGAATGGTCACCCTGTTCTGCA 3' ||||||||||||||||||||||||| 3' TACCCTTACCAGTGGGACAAGACGT 5' 5' ATGGGAATTGTCACCCTGTTCTGCA 3' |||||||| |||||||||||||||| 3' TACCCTTACCAGTGGGACAAGACGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold24597:1398064..1398088 24/25 unknown
Scaffold3467:3854941..3854965 24/25 Antisense target fgfr3.L
Scaffold251007:172600..172624 22/25 unknown
Scaffold296242:779368..779392 21/25 unknown
Scaffold373399:2494329..2494353 21/25 unknown
Scaffold51671:1090612..1090636 21/25 unknown
Scaffold53263:4903136..4903160 21/25 Sense off-target Xelaev16061147m
Scaffold145781:24367..24391 21/25 Antisense off-target appl1.L
Scaffold191239:147..171 21/25 unknown
Scaffold7197:526048..526072 21/25 Antisense off-target Xelaev16070143m
Scaffold8129:6587648..6587672 21/25 unknown
tropicalis 7.1 scaffold_1:199151205..199151229 25/25 Antisense target fgfr3
scaffold_10:37900138..37900162 21/25 unknown
scaffold_88:91640..91664 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556