Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311288

Morpholino Name: fgfr4 MO5
Synonyms: TEgg061a19, XtFgfr4a-1
mRNA Target: fgfr4

Morpholino Type:
Sequence:
5' GGCTCCCCATTCATAAGAAGTCCGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' GCGGACTTCTTATGAATGGGGAGCC 3' ||||||||||||||||||||||||| 3' CGCCTGAAGAATACTTACCCCTCGG 5' 5' GTGGACTTCTTATGAATGGGGAGAG 3' | ||||||||||||||||||||| 3' CGCCTGAAGAATACTTACCCCTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold54899:541856..541880 22/25 Antisense off-target ovch1.L
Scaffold5925:11210457..11210481 22/25 Antisense target fgfr4.S
tropicalis 7.1 scaffold_3:74878938..74878962 25/25 Antisense target fgfr4
scaffold_1:42578426..42578450 21/25 Sense off-target kremen1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556