Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311294

Morpholino Name: fzd6 MO1
Synonyms: TGas087l14, Xtfrizzled6, frizzled6
mRNA Target: fzd6

Morpholino Type:
Sequence:
5' CACCTTGCCTAATCTAGCTGCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GATGGCAGCTAGATTAGGCAAGGTG 3' ||||||||||||||||||||||||| 3' CTACCGTCGATCTAATCCGTTCCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_6:18332616-18332640 25/25 Antisense target fzd6
scaffold_6:66652799-66652823 22/25 unknown
scaffold_7:51580305-51580329 21/25 Antisense off-target slc28a2
scaffold_7:82736870-82736894 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556